Transcripción del adn






descargar 73.55 Kb.
títuloTranscripción del adn
fecha de publicación29.07.2015
tamaño73.55 Kb.
tipoTranscripción
ley.exam-10.com > Química > Transcripción
MADRID / SEPTIEMBRE 11. LOGSE / BIOLOGIA / GENETICA / OPCIÓN A /

ACTIVIDAD 2
OPCIÓN A



a) La transcripción del ADNes el primer proceso de la expresión génica, mediante el cuál se transfiere la información contenida en la secuencia del ADN hacia la secuencia de proteína utilizando diversos ARN como intermediarios. Durante la transcripción genética, las secuencias de ADN son copiadas a ARN mediante una enzima llamada ARN polimerasa que sintetiza un ARN mensajero que mantiene la información de la secuencia del ADN. De esta manera, la transcripción del ADN también podría llamarse síntesis del ARN mensajero.

b) A: ADN , B: ARN mensajero.




3´ 3´ 5´ 5´


c) DIFERENCIAS ENTRE ADN Y ARN




ADN

ARN

COMPOSICIÓN

A, T, G, C

Desoxirribosa

A, U, G, C

Ribosa

LOCALIZACIÓN

Núcleo e interior de mitocondria y cloroplastos

Núcleo y citoplasma

ESTRUCTURA

Generalmente bicatenaria

Monocatenaria

FUNCIÓN

Material genético

Siempre relacionada con la síntesis protéica

En el caso del ARN mensajero es una copia complementaria de una porción de una cadena de ADN que servirá de pauta para la síntesis de una proteína.

Una vez formado pasa al citoplasma donde se asocia a ribosomas para ser traducido a proteínas.

Una vez traducido a proteínas es destruido por enzimas ribonucleasas,
d) Son las cadenas complementarias que forman el ADN. Sólo una de ellas se transcribe, en este caso la C que se denomina cadena molde

F es la enzima denominada ARN polimerasa


MADRID / JUNIO 11. LOGSE / BIOLOGIA / GENETICA / OPCIÓN B /

ACTIVIDAD 1
OPCIÓN B

1.- Dado el siguiente fragmento de ADN que será transcrito y traducido

5´ AAATGCTACAAT 3´

3´ TTTACGATGTTA 5´

a) Escriba la secuencia de nucleótidos y polaridad del ARNm

que se sintetizaría utilizando como molde la cadena inferior del ADN (0,5 puntos).

b) Proporcione los anticodones de los ARNt con sus polaridades (0,5 puntos).

c) Escriba la secuencia de aminoácidos del tetrapéptido que se sintetizaría (0,5 puntos).

d) Explique qué ocurriría si en el triplete que codifica para Tyr se cambia la C por A o G ¿Cuáles serían sus consecuencias? (0,5 puntos).



  1. Secuencia: 5´AAAUGCUACAAU 3´




  1. Codones: 5´AAA3´ 5´UGC3´ 5´UAC3´ 5´AAU3´

Anticodones: 3´UUU5´ 3´ACG5´ 3´AUG5´ 3´UUA5´

c) Aminoácidos: Lys Cys Tyr Asn
d) Si se cambia la C por A el codon sería UAA que corresponde con un triplete de terminación por lo que el codon siguiente no sería leido y no se uniría al tetrapeptido el aminoácido Asn

Si cambia la C por G el codon sería UAG que igual que antes corresponde a un triplete de terminación
MADRID / JUNIO 09. LOGSE / BIOLOGIA / GENETICA / OPCIÓN B /

ACTIVIDAD 4
OPCIÓN B

3.- Referente a la expresión del material hereditario:

a) Represente mediante un esquema rotulado “El Dogma Central de la Biología Molecular” actualizado (0,5 puntos).

b) Explique brevemente las tres etapas del proceso de la transcripción en procariontes (0,75 puntos).

c) El siguiente esquema representa un ARN transcrito primario procedente de un fragmento de un gen, correspondiente a una célula eucariota.

5´Exón Intrón Exón Intrón 3´

Explique brevemente el proceso de maduración de este ARN transcrito primario hasta obtener su ARNm maduro (0,75 puntos).

a)



b)

Iniciación

El ADN posee en distintos lugares los llamados “centros promotores” cuyo función es indicar cómo se inicia la transcripción y en cuál de las dos hebras. Están constituidos por determinadas secuencias de bases (TATA).

La ARN polimerasa reconoce el centro promotor se une a él y hace que la doble hélice de ADN se abra para permitir que quede expuesta la secuencia de bases del ADN molde que va a ser transcrita.

Elongación

Es la adición de los sucesivos ribonucleótidos para formar el ARN.

La ARN-polimerasa lee la cadena de ADN en sentido 3´ 5´ mientras que el sentido de síntesis del ARN es 5´ 3´.

Se van añadiendo nucleótidos uno a uno en el extremo 3´de la cadena en crecimiento. Es decir la enzima selecciona el ribonucleótido trifosfato cuya base es complementaria con la de la cadena de ADN molde, y lo une mediante enlace ester al OH situado en posición 3´de la cadena en crecimiento desprendiéndose un grupo pirofosfato (PPi) .

En eucariontes tras la unión de los 30 primeros ribonucleótidos se añade en el extremo 5´ una “caperuza” formada por metil-guanosil-fosfato, que protege este extremo del ataque de las nucleasas, y en la traducción será una señal de reconocimiento de iniciación de la lectura.


Terminación

Existen señales de terminación que indican el fin de la transcripción. Esto implica el cierre de la burbuja formada en el ADN y la separación de la ARN-polimerasa, y del ARN transcrito.

En procariontes la señal de terminación es una secuencia “palindrómica” (tiene la misma lectura de izquierda a derecha y de derecha a izquierda) formada por G y C seguidas de varias T que origina al final del ARN un bucle u horquilla por autocomplementariedad de las bases G y C. Esto favorece su separación del ADN.
c) A veces los ARNm transcritos no se pueden traducir directamente sino que requieren un proceso previo de procesamiento o maduración postranscripcional..

En eucariontes cada gen consta de varios fragmentos denominados “intrones “ y “exones” intercalados unos con otros.

Los intrones son secuencias de bases más o menos largas que se transcriben pero que no se traducen, es decir, no codifican una secuencia de aa.

Los exones son secuencias que se transcriben y se traducen, es decir, tienen información para formar una cadena polipeptídica.

El transcrito primario está formado por intrones y exones. Su maduración consiste en eliminar los intrones y unir los exones mediante un mecanismo que se denomina”empalme” o splicing.

El empalme requiere la enzima “ribonucleoproteína pequeña nuclear” RNPpn.

  • Comienza cuando las secuencias intrónicas forman unos bucles que provocan el acercamientode los extremos de los exones.

  • A continuación se cortan los intrones

  • Se unen los exones

En este momento el ARNm está preparado para salir del núcleo.

Los intrones no existen en procariontes y no se sabe el papel que cumplen en eucariontes.

Si se sabe que un mismo gen puede madurar de diferentes maneras dependiendo de cómo se eliminen los intrones

MADRID / JUNIO 09. LOGSE / BIOLOGIA / GENETICA / OPCIÓN B /

ACTIVIDAD 3
OPCIÓN B

3.- Con referencia a distintos procesos biológicos:

a) Para replicarse en células eucarióticas, un virus de ARN monocatenario (similar al del VIH) debe integrarse en el genoma de la célula huésped, que es ADN bicatenario. Explique las distintas etapas del proceso de

replicación (1,5 puntos).

b) Si en otro Planeta hubiera un ADN constituido por 6 nucleótidos distintos, existieran 216 aminoácidos esenciales y el código genético estuviera constituido por tripletes, ¿sería posible que existiera un mecanismo de traducción igual al de la Tierra? Razone la respuesta (0,5 puntos).

a)Las fases de la replicación son; iniciación, elongación y terminación

  1. Iniciación:

Consiste en el desenrrollamiento y apertura de la doble hélice.

Comienza en una región del ADN llamada “punto de iniciación” donde abundan las secuencias de bases GATC.

El punto de iniciación es reconocido por proteínas específicas que se unen a él.

Enzimas helicasas rompen los enlaces de hidrógeno que unen bases complementarias, abriendo la doble hélice.

Cuando la doble hélice se abre se produce desenrrollamiento en esa zona, lo que provoca superenrrollamientos en las zonas vecinas. Las enzimas girasas y topoisomerasas evita esas tensiones.

Después las proteínas de unión a cadena simple (SSB) se unen a las hebras individuales e impiden que se vuelvan a enrollar.

Alrededor del origen de replicación se ha formado una “burbuja de replicación” o replicón en la que hay 2 zonas con forma de Y, denominadas “horquillas de replicación”, donde se van a sintetizar las nuevas hebras de ADN.

La burbuja de replicación se va extendiendo a lo largo del cromosoma en los dos sentidos, por este motivo la replicación es bidireccional

  1. Elongación

Es la fase en la que se sintetiza una nueva hebra de ADN sobre cada hebra (molde) de la doble hélice original.

Además de las enzimas que participan en la iniciación en la elongación intervienen ADN polimerasas. Hay varios tipos que se nombran I, II y III. Sus funciones son:

  • Actividad polimerasa: Reconocen la hebra molde, seleccionan el desoxirribonucleótido cuya base es complementaria con la de la hebra molde, y lo unen. Las nuevas cadenas se sintetizan por unión de nucleótidos trifosfato, la energía para el enlace se obtiene de la hidrólisis de los dos grupos fosfato del nucleótido entrante.

  • Actividad exonucleasa: elimina nucleótidos cuyas bases están mal apareadas, asi como fragmentos de ARN.

Las ADN polimerasas no pueden iniciar de cero la síntesis de la nueva cadena; necesitan un fragmento de 10 nucleótidos de ARN denominado “cebador o primer” con el extremo 3´ libre al que añadir los nuevos nucleótidos.

El cebador se sintetiza por una enzima ARN polimerasa denominada “primasa”.

La ADN polimerasa recorre las hebras molde en sentido 3´ 5´ y va uniendo los nuevos nucleótidos en el extremo 3´(sentido de la hebra en formación 5´ 3´).

Como la replicación sólo ocurre en un sentido y las 2 cadenas de ADN son antiparalelas, se planteaba cómo se efectuaría la replicación en los dos brazos de la horquilla. La solución la aportó Okazaki al encontrar que una cadena, la que se sintetiza en sentido 5´ 3, lo hace de forma continua como una sola unidad. A esta hebra se le denomina conductora o lider. Mientras que la otra (3´ 5´) se forma de manera discontinua como una serie de fragmentos sintetizados cada uno en el sentido 5´ 3´ que después se unen formando la “cadena retardada o retrasada”.

Cada uno de los fragmentos requiere un cebador de ARN sintetizado por la primasa cada ciertos intervalos. La ADN polimerasa va eliminando el cebador y sustituyéndolo por ADN. Por último una ADN ligasa une los fragmentos obtenidos.

  1. Terminación

Cuando se llega a la secuencia de terminación o TerC las nuevas dobles hélices terminan de formarse y se separan

b) En el código genético humano tenemos 4 nucleótidos y 20 aa; las 4 nucleótidos forman tripletes y por tanto son 64 tripletes distintos, correspondiendo varios tripletes a cada aa a excepción de la metionina.

En el supuesto planeta tiene 6 nucleótidos y 216 aa. Si los nucleótido se agrupan en tripletes serrán 63 es decir 216. Por tanto a cada aa le correspondería un triplete , pero no habría triplete de terminación o stop.

Por tanto la traducción NO sería como en la tierra porque a cada aa sólo le correspondería un triplete y No habria tripletes de terminación.
MADRID / SEPTIEMBRE 07. LOGSE / BIOLOGIA / GENETICA / OPCIÓN A /

ACTIVIDAD 4
OPCIÓN A

4.- Referente a la expresión de la información hereditaria:

a) Defina el proceso de transcripción e indique las etapas del mismo (0,5 puntos).

b) Cite el nombre de la enzima implicada en este proceso. ¿Cómo se denominan las secuencias del ADN donde se une esta enzima para el comienzo de la transcripción? (0,5 puntos).

c) Asocie a los procesos de transcripción y traducción los siguientes términos:

ARNm/ ARNt/ ARN polimerasa/ribosoma/codón/ aminoácido/sitioP/ anticodón/ procesamiento o maduración/sitio A/intrón (1punto).
a) Como el ADN se encuentra en el núcleo y las proteínas se sintetizan en el citoplasma, resultó evidente que tenía que existir un intermediario entre los genes del núcleo y los ribosomas donde se sintetizan las proteínas.

El intermediario es el ARNm que transporta la información de los genes a las proteínas.

Para esto es necesario que se sintetice ARNm a partir de un molde de ADN.

La trascripción es la síntesis de ARNm a partir de un molde de ADN.

Las estapas son: iniciación, elongación, terminación y maduración (sólo en células eucaritotas)
b)Hay varias ,tomoisomerasas, helicasas,… pero la mas importante es la ARN polimerasa- La ARN polimerasa se une a un “centro promotor” que cuya función es indicar cómo se inicia la transcripción y en cuál de las dos hebras. Están constituidos por determinadas secuencias de bases (TATA).

c)ARNm: Es una copia complementaria de una porción de una cadena de ADN que servirá de pauta para la síntesis de una proteína. Asociado a la transpción

ARNt: actúa como transportador de aa hasta los ribosomas, durante la síntesis protéica. Asociado a la traducción

ARNpolimerasa: Enzima que cataliza la síntesis de ARN- Asociado a la transcripción

Ribosoma: Orgánulo citoplasático asociado a la traducción

Codón: Triplete de nucleótidos en el ARNm que tiene en correspondiente con un aa según el codigo genético- Asociado a la traducción

Aminoácido: monómero constituyente de las proteínas. Asociado a la traducción

Sitio P: Lugar en el ribosoma donde se localiza el ARNt que lleva el polipéptido en formación. Asociado a la traducción

Anitcodon: Triplete de nucleotidos en el ARNt que es complementario del codon de ARNm. Asociado a la traducción

Procesamiento o madurcación: Última fase de la ranscripción en células eucariotas. Asociado a la transcripción

Sitio A: Lugar en el ribosoma donde se una el ARNt que lleva asociado un aa que se va a unir a la cadena polipeptídica en formación. Asociado a la traducción

Intrón: Fragmento de nucleótidos en el ARNm de células eucariotas que no va a ser traducido a aa y por tanto es eliminado en el proceso de maduración del ARNm durante la transcripción

MADRID / SEPTIEMBRE 05. LOGSE / BIOLOGIA / GENETICA / OPCIÓN A /

ACTIVIDAD 4
OPCIÓN A

4. Referente al código genético y mutación:

A partir de la siguiente secuencia de bases de un fragmento de un gen

5´ TAT ATA CAA TTT 3´

3´ ATA TAT GTT AAA 5 ´

a) Indique cuál será la secuencia de ARNm correspondiente a la

cadena inferior de este fragmento, indicando su polaridad (0,5

puntos).

b) Ayudándose de la tabla del código genético escriba la secuencia de

aminoácidos del polipéptido codificado por ese fragmento de gen

indicando los extremo carboxilo y amino (0,5 puntos).

c) Si en el ADN se produjese una sustitución del par C-G por el par TA,

indique como se altera el ARNm y la cadena polipeptídica (0,5

puntos)

d) Explique qué significa que el código genético es degenerado (0,5

puntos).


RESPUESTA:

a) La transcripción es la primera fase de la síntesis proteica. El proceso consiste en la síntesis de un ARNm, tomando como molde una de las dos cadenas del ADN y está catalizado por las ARN-polimerasas. Estas enzimas se desplazan a lo largo de la cadena de ADN “leyéndola” en sentido 3´-5´, mientras que el sentido de síntesis del ARN es 5´-3´.

Para poder averiguar la secuencia del ARNm transcrito a partir de la secuencia de ADN indicada en la figura hay que tener en cuenta:

1. La ley de complementaridad de bases.

2. El sentido de síntesis de las ARN polimerasas.

3. La timina es exclusiva del ADN y el uracilo del ARN.

Por lo tanto, la secuencia del ARNm transcrita a partir de la secuencia de ADN de la figura será la siguiente:

ADN 5´ TAT ATA CAA TTT 3´

3´ ATA TAT GTT AAA 5 ´

ARNm 5´ UAU AUA CAA UUU 3´
b) La traducción es la segunda fase del proceso de síntesis proteica. En esta etapa se traduce en proteínas la información genética transferida desde el ADN al ARNm durante la transcripción. Los aminoácidos dispersos en el citoplasma deben unirse para formar los polipéptidos según una secuencia lineal, que no es otra que la ordenada por el ADN y transportada por el ARNm.

Para poder averiguar la secuencia de aminoácidos a partir de la secuencia de

ARNm transcrito de la figura hay que tener en cuenta:

- el código genético,

- la translocación del ribosoma para la lectura del ARNm implica el

desplazamiento del ribosoma a lo largo del ARNm en sentido 5´→3´,

- el grupo carboxilo del aminoácido iniciador se une al grupo amino del segundo

aminoácido y, por tanto, el primer aminoácido presenta el grupo amino libre y

el último el grupo carboxilo como terminal.

ARNm 5´ UAU AUA CAA UUU 3´

Secuencia de NH3- Tir - Ile – Gln – Fen – COOH

Aminoácidos

c) Un gen es un segmento de ADN con la información necesaria para la síntesis de una cadena polipeptídica. La secuencia de nucleótidos de ese gen es específica para cada cadena polipeptídica. Cualquier cambio en la secuencia de nucleótidos de un gen conduce a alteraciones o cambios en la molécula que codifica. Las mutaciones moleculares, también denominadas puntuales, son las que afectan a la secuencia de nucleótidos.

La sustitución del par G-C por el par A-T daría lugar a la formación del codón

AAA que codifica para el lisina. La secuencia polipéptidica cambia siendo la

siguiente: NH3- Tir - Ile – Lys – Fen – COOH

d) El código genético es degenerado, es decir, al estar compuesto por 64 codones, varios tripletes codifican para un mismo aminoácido. Casi todos ellos tienen en común los dos primeros nucleótidos, ofreciendo la variabilidad en el tercero.

MADRID / SEPTIEMBRE 04. LOGSE / BIOLOGÍA / GENÉTICA / OPCIÓN A /

CUESTIÓN 4
OPCIÓN A

4. En relación con la información genética y sus alteraciones:

a) Si un polipéptido tiene 450 aminoácidos, indique cuántos ribonucleótidos

tendrá el fragmento del ARNm que codifica esos aminoácidos. Razone la

respuesta (0,5 puntos).

b) 5´ GUU-UCC-GCA-UGG3 ´, son cuatro codones de una molécula de

ARNm.

c) Suponga que un fragmento de ADN que codifica un polipéptido se

reproduce una mutación puntual que afecta a un par de bases. Debido a

ello, cuando la célula sintetice de nuevo el polipéptido, a éste le podría haber

ocurrido uno de los cuatro hechos siguientes:

1. Que se codifique el mismo aminoácido que el sintetizado antes de

la mutación.

2. La sustitución de un aminoácido por otro distinto.

3. Que el nuevo polipéptido sintetizado sea más corto.

4. Que el nuevo polipéptido sintetizado sea más largo.

Basándose en sus conocimientos del código genético, explique el por qué cada uno de estos resultados. (1puntos).

Solución:

a) Un codón es cada grupo de tres nucleótidos del ARN mensajero que codifica para

una aminoácido y, durante, la traducción, se corresponde con un anticodón del ARN

transferente poseedor de tres nucleótidos cuyas bases nitrogenadas son complementarias

del codón.

Por tanto, su un polipéptido tiene 450 aminoácidos, el fragmento de ARN que lo

codifica poseerá 450 x 3 = 1350 ribonucléotidos.
b) Efectivamente puesto que el uracilo es exclusivo del ARN.

c) Caso 1. Como el código genético es degenerado, el triplete puede sustituirse por otro

que codifique el mismo aminoácido, de modo que la mutación no afectaría al enzima y

sería una mutación silenciosa o nula.

Caso 2: El triplete originado por mutación codifica otro aminoácido.

Caso 3: La mutación puntual origina un triplete de terminación de modo que el gen

codificará un polipéptido más corto.

Caso 4: La mutación afecta al triplete de terminación codificando otro aminoácido.

MADRID / SEPTIEMBRE 03. LOGSE / BIOLOGÍA / GENÉTICA / OPCIÓN A / Nº 4
OPCIÓN A

4. En relación con la expresión génica:

a) Explique en que consiste el proceso de traducción y cite en qué

estructuras de la célula se produce. (0,5 puntos)

b) Indique el papel que desempeñan en este proceso los sitios A y P del

ribosoma y la enzima aminoacilARNt-sintetasa. (0,75 puntos)

c) Indique como se denomina el triplete de bases que en el ARNm codifica

para una aminoácido específico, cómo se denomina el triplete de bases

complementarias en el ARNt e indique cuál sería el triplete de bases del

ARNt si su complementario para el aminoácido valina en el ARNm es

GUA. (0,75 puntos)

Solución:

a) La traducción es la segunda fase del proceso de síntesis proteica, tiene lugar en el citoplasma celular, donde se encuentran los ribosomas. En esta etapa se traduce en proteínas la información genética transferida desde el ADN al ARNm durante la transcripción. Los aminoácidos dispersos en el citoplasma deben unirse para formar los polipéptidos según una secuencia lineal, que no es otra que la ordenada por el ADN y transportada por el ARNm.
b y c) La activación de los aminoácidos en una fase previa a la traducción que se lleva a cabo en presencia de la enzima aminoacil-ARNt-sintetasa y de ATP y consiste en la unión de el ARNt y su aminoácido específico dando lugar a un aminoacil-ARNt liberándose AMP, Ppi y quedando libre la enzima, que vuelve a actuar. La unión del aminoácido al ARNt se produce en el extremo de la cadena de éste donde están los tres nucleótidos fijos (adenina, guanina, citosina).

La iniciación es la primera etapa de la traducción y en ella el ARNm se une a la

subunidad menor de los ribosomas. A éstos se asocia el aminoacil-ARNt gracias a que el lazo de ARNt opuesto al punto de fijación del aminoácido (lazo anticodón) posee tres bases, denominadas anticodón, complementarias de un triplete o codón del ARNm. A este grupo de moléculas de une la subunidad ribosómica mayor, formándose el complejo de iniciación. Este complejo ribosomal posee dos sitios de unión. El centro denominado peptidil (P), donde se sitúa el primer aminoacil- ARNt, y el centro aminoacil (A) o aceptor de nuevos aminoacil-ARNt.

Por último, si el codón del ARNm para valina es GUA, el anticodón presente en el ARNt específico para este aminoácidos será CAU.

MADRID / SEPTIEMBRE 00. LOGSE / BIOLOGIA / GENETICA / OPCION A /

EJERCICIO 4
OPCION A

4. La siguiente secuencia nucleotídica corresponde a un fragmento del inicio de un gen de una cepa bacteriana:

3´ TACAATTCCCGGGCAACACAC 5´

a) Escriba la secuencia de bases del ARN mensajero que se puede sintetizar e indique su polaridad (0,5 puntos).

b) ¿Cuál es el número máximo de aminoácidos que puede codificar este fragmento (0,5 puntos).

c) ¿Qué características del código genético ha utilizado para determinar el número de aminoácidos? (0,5 puntos).

d) Si se detectara una variante de la cepa que produjera un polipéptido de cinco aminoácidos, ¿cómo pudo producirse la variante? (0,5 puntos).

Solución:

a) La transcripción: es la primera fase de la síntesis proteica. El proceso consiste en la síntesis de un ARNm, tomando como molde una de las dos cadenas del ADN y está catalizado por las ARN-polimerasas. Estas enzimas se desplazan a lo largo de la cadena de ADN “leyéndola” en sentido 3´-5´, mientras que el sentido de síntesis del ARN es 5´-3´.

Para poder averiguar la secuencia de las dos hebras de ADN del que proviene el ARN de la figura hay que tener en cuenta:

1. La ley de complementaridad de bases.

2. El sentido de síntesis de las ARN polimerasas.

3. La timina es exclusiva del ADN y el uracilo del ARN.

Por lo tanto, la secuencia del ARNm transcrita a partir de la secuencia de ADN de la figura será la siguiente:

ADN 3´ TACAATTCCCGGGCAACACAC 5´

ARNm 5´ AUGUUAAGGGCCCGUUGUGUG 3´
b y c) La clave genética establece la relación que hay entre la secuencia de nucleótidos de los genes y la secuencia de aminoácidos de las proteínas, es decir, la relación existente entre la estructura primaria de ambos tipos de biomoléculas.

Para descifrar el código genético se utilizó como hipótesis de trabajo que tres bases (un codón) codificaban un aminoácido, ya que el número de secuencias posibles formadas por tres nucleótidos es 43 = 64, número más que suficiente para codificar los 20 aminoácidos proteicos. Si los codones se formasen con dos letras, el número de secuencias posibles sería 42= 16 y, por tanto, no sería un número suficiente para codificar los 20 aminoácidos.

Además hay que tener en cuenta una característica general del código genético que consiste en que la lectura es sin comas o sin solapamiento.

Partiendo de lo anteriormente expuesto, el número máximo de aminoácidos que puede codificar el fragmento del enunciado es 7.

5´ AU G/UUA/AGG/GCC/CGU/UGU/GUG 3´
d) Un gen es un segmento de ADN con la información necesaria para la síntesis de una

cadena polipeptídica. La secuencia de nucleótidos de ese gen es específica para cada cadena polipeptídica. Cualquier cambio en la secuencia de nucleótidos de un gen conduce a alteraciones o cambios en la molécula que codifica.

Las mutaciones moleculares, también denominadas puntuales, son las que afectan a la secuencia de nucleótidos. Las mutaciones puntuales pueden producirse por:

a) Sustitución de nucleótidos o bases: es decir, por ejemplo, donde existía un nucleótido de adenina, se instala uno de timina.

b) Pérdida de nucleótidos.

c) Inserción de nuevos nucleótidos.

Por ejemplo, en el caso de una mutación por sustitución de bases al sólo afectar a uno de los nucleótidos, es un único triplete el que se ve afectado. Como el código genético es degenerado, el triplete puede sustituirse por otro que codifique el mismo aminoácido, de modo que la mutación no afectaría al enzima y sería una mutación silenciosa o nula. Sin embargo, si se detectase una variante de la cepa que produjese un polipéptido de cinco aminoácidos se debería a que la mutación puntual daría lugar a un codón de terminación..

MADRID / SEPTIEMBRE 99. LOGSE / BIOLOGÍA / GENÉTICA / OPCIÓN A / Nº 3
3.- La transcripción y la traducción son procesos fundamentales en la célula eucariota.

a) Defina y distinga entre ambos procesos e indique en qué parte de la célula se produce cada uno de ellos (1 punto).

b) Nombre los tipos de ARN que intervienen en la traducción e indique la función de cada uno de ellos. (1 punto).

Solución:

a) La transcripción: es la primera fase de la síntesis proteica o expresión del material genético. El proceso consiste en la síntesis de ARN, tomando como molde una de las dos cadenas del ADN. El proceso está catalizado por el enzima ARN-polimerasa-ADN dependiente o transcriptasa, y se inicia con la desespiralización parcial de la doble hebra de ADN que se va a transcribir.

La trancripción en eucariotas tiene lugar en el núcleo celular. En procariotas, al no exisitir núcleo, ésta fase tiene lugar en el citoplasma donde se encuentra ubicado el nucleoide o material genético.

La traducción: es la segunda sfase del proceso de síntesis proteica. En esta etapa se traduce en proteínas la información genética transferida desde el ADN al ARNm durante la transcripción. Los aminoácidos dispersos en el citoplasma deben unirse para formar los polipéptidos según una secuencia lineal, que no es otra que la ordenada por el ADN y transportada por el ARNm.

La traducción en eucariotas tiene lugar en el citoplasma celular y en el retículo endoplásmico rugoso: El ARNm procedente del núcleo abandona éste a través de los poros nucleares, dirigiéndose a los ribosomas. En procariotas, transcripción y traducción son procesos simultáneos.
b) El ARN es uno de los dos tipos de ácidos nucleicos que existen. Está formado por una sóla cadena de nucleótidos. En las células eucariotas se encuentra en el citoplasma y en orgánulos como las mitocondrias, cloroplastos y ribosomas. Se han descrito tres tipos de ARN con características estructurales y funcionales que les distinguen, pero todos tienen en común que proceden del ADN (por un proceso de síntesis denominado transcripción) y de modo general, todos participan en el proceso de síntesis proteica dirigido por el ADN. Los tres tipos son:

- ARN ribosómico (ARNr): Es de elevado peso molecular, se encuentra asociado a las proteínas en los ribosomas de cuya masa constitye hasta el 60 %. Su función durante la biosíntesis de proteínas consiste en crear, junto a los proteínas ribosómicas, el ambiente molecular adecuado para que se instale el ARNm y los aminoácidos que participan en la síntesis proteica. desoxirribonucleótidos, se sintetiza durante la transcripción en el núcleo, y en menor cantidad en las mitocondrias y cloroplastos. Su función consiste en copiar y transmitir el mensaje genético, almacenado en la secuencia de nucleótidos del ADN, hasta los ribosomas, que representan el lugar donde la información se traduce como secuencia de aminoácidos de una proteína.

- ARN transferente (ARNt): Existen diferentes tipos, todos son moléculas relativamente pequeñas formadas por 70-90 nucleótidos. Hay, al menos un ARNt por aminoácido presente en las proteínas. Posee una estructura secundaria característica de “hoja de trébol” que presenta tres lazos. La función de cada uno de los ARNt es la de transportar un aminoácido específico desde el citoplasma al ribosoma. Este proceso se basa en cada uno de los diferentes tipos de ARNt posee en uno de sus lazos una región denominada anticodón, compuesta por tres nucleótidos específicos que son complementarios de algunos tripletes del ARNm que representan el denominado codón. Por otro lado, la secuencia que se encuentra en los extremos 5´y 3´ (principio y final de la cadena) termina siempre en los tres nucleótidos CCA-3´ que es lugar donde se une un determinado aminoácido en el citoplasama.

MADRID / SEPTIEMBRE 98. LOGSE / BIOLOGÍA / GENÉTICA / OPCIÓN A / Nº 3
3.- Observe el esquema siguiente:

a) ¿Cómo se denomina cada una de las etapas del mismo?. (1 punto).

b) Indique cuáles de estas etapas se producen normalmente en la célula eucariótica, indicando dónde se produce cada una de ellas. (1 punto).

Observaciones:

Esta cuestión pertenece al bloque de contenidos n.º 5: La base química de la herencia: genética molecular, y para resolverla tenemos que recordar los conceptos relacionados con la replicación, transcripción y traducción de la información genética.

Solución:

Los ácidos nucleicos son los portadores de la información biológica de un ser vivo, es decir, de cómo son todas las moléculas que constituyen el individuo y de cuándo se han de producir. Esta información se transmite de generación en generación a través del ADN, por lo que éste es el portador de la información genética.

a) La capacidad de las células de mantener el elevado grado de orden dentro del universo caótico, deriva de la información genética que se expresa, mantiene, replica y a veces mejora mediante cuatro procesos genéticos básicos: síntesis proteica, reparación del ADN, replicación del ADN y recombinación genética. Estos procesos que producen y mantienen las proteínas y los ácidos nucleicos de una célula, son unidimensionales: en cada uno de ellos, la información de una secuencia lineal de nucleótidos se utiliza para producir o alterar otra cadena lineal de nucléotidos (una molécula de ADN o ARN) o una cdena lineal de aminoácidos (una molécula proteica).

Las etapas del esquema se denominan de la siguiente manera:

1.- Replicación.

2.- Transcripción.

3.- Transcripción inversa.

4.- Traducción.
b) En la célula eucariótica tienen lugar los siguiente procesos o etapas: replicación, transcripción y traducción de la información genética.

La replicación del ADN en eucariotas tiene lugar en el núcleo celular.

La transcripción, o mecanismo de síntesis de ARN a partir de una ADN que es utilizado como molde, es un proceso que se realiza también en el núcleo celular.

La traducción o síntesis proteica, es un proceso que tiene lugar en los ribosomas del citoplasma de las células eucariotas.

Añadir el documento a tu blog o sitio web

similar:

Transcripción del adn iconLa transcripción de la siguiente cadena de adn: cgcattcgc, dará lugar a un arn de secuencia

Transcripción del adn iconAdn: (Ácido Desoxirribonucleico.) El ácido desoxirribonucleico (adn)...

Transcripción del adn iconSintesis o duplicación del adn

Transcripción del adn iconTranscripción del

Transcripción del adn iconTranscripción del foro

Transcripción del adn iconTranscripción del audio original

Transcripción del adn iconTranscripción: Especial Día del Respeto a la Diversidad Cultural

Transcripción del adn iconTranscripción del debate mantenido con artur mas en el aula el país el 29/10/2003

Transcripción del adn iconAdn y arn

Transcripción del adn iconTrabajo de investigación adn






© 2015
contactos
ley.exam-10.com